ID: 1203133277

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1705370-1705392
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203133268_1203133277 14 Left 1203133268 16_KI270728v1_random:1705333-1705355 CCTTAGCTCGAGGCGGACGCGGC No data
Right 1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG No data
1203133266_1203133277 15 Left 1203133266 16_KI270728v1_random:1705332-1705354 CCCTTAGCTCGAGGCGGACGCGG No data
Right 1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG No data
1203133263_1203133277 29 Left 1203133263 16_KI270728v1_random:1705318-1705340 CCTAGCTGGCGGGACCCTTAGCT No data
Right 1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG No data
1203133273_1203133277 -8 Left 1203133273 16_KI270728v1_random:1705355-1705377 CCCGGACCCGGTGGATGTGGAGC No data
Right 1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG No data
1203133274_1203133277 -9 Left 1203133274 16_KI270728v1_random:1705356-1705378 CCGGACCCGGTGGATGTGGAGCA No data
Right 1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203133277 Original CRISPR TGTGGAGCAGTCGCCGCTGC CGG Intergenic