ID: 1203141221

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1768050-1768072
Sequence AAAGCTGCATGGCCCCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203141221_1203141227 28 Left 1203141221 16_KI270728v1_random:1768050-1768072 CCAATAGGGGGCCATGCAGCTTT No data
Right 1203141227 16_KI270728v1_random:1768101-1768123 AGTTCCGACGTTCTATTTGGGGG No data
1203141221_1203141226 27 Left 1203141221 16_KI270728v1_random:1768050-1768072 CCAATAGGGGGCCATGCAGCTTT No data
Right 1203141226 16_KI270728v1_random:1768100-1768122 TAGTTCCGACGTTCTATTTGGGG No data
1203141221_1203141225 26 Left 1203141221 16_KI270728v1_random:1768050-1768072 CCAATAGGGGGCCATGCAGCTTT No data
Right 1203141225 16_KI270728v1_random:1768099-1768121 TTAGTTCCGACGTTCTATTTGGG No data
1203141221_1203141223 3 Left 1203141221 16_KI270728v1_random:1768050-1768072 CCAATAGGGGGCCATGCAGCTTT No data
Right 1203141223 16_KI270728v1_random:1768076-1768098 TCTGAGTGTATTTGTGATTGTGG No data
1203141221_1203141224 25 Left 1203141221 16_KI270728v1_random:1768050-1768072 CCAATAGGGGGCCATGCAGCTTT No data
Right 1203141224 16_KI270728v1_random:1768098-1768120 GTTAGTTCCGACGTTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203141221 Original CRISPR AAAGCTGCATGGCCCCCTAT TGG (reversed) Intergenic
No off target data available for this crispr