ID: 1203143106

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1781825-1781847
Sequence GTGGATCCCCAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203143101_1203143106 7 Left 1203143101 16_KI270728v1_random:1781795-1781817 CCAGATGGGTGTGACTATTGTAG No data
Right 1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203143106 Original CRISPR GTGGATCCCCAGATGGAGGA TGG Intergenic
No off target data available for this crispr