ID: 1203143164

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1782208-1782230
Sequence CACTCAGTGTCCTCCATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203143164_1203143170 19 Left 1203143164 16_KI270728v1_random:1782208-1782230 CCCCAGATGGAGGACACTGAGTG No data
Right 1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG No data
1203143164_1203143167 -3 Left 1203143164 16_KI270728v1_random:1782208-1782230 CCCCAGATGGAGGACACTGAGTG No data
Right 1203143167 16_KI270728v1_random:1782228-1782250 GTGTGTCTATTGTAGAGTGTAGG No data
1203143164_1203143168 0 Left 1203143164 16_KI270728v1_random:1782208-1782230 CCCCAGATGGAGGACACTGAGTG No data
Right 1203143168 16_KI270728v1_random:1782231-1782253 TGTCTATTGTAGAGTGTAGGTGG No data
1203143164_1203143169 12 Left 1203143164 16_KI270728v1_random:1782208-1782230 CCCCAGATGGAGGACACTGAGTG No data
Right 1203143169 16_KI270728v1_random:1782243-1782265 AGTGTAGGTGGATCCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203143164 Original CRISPR CACTCAGTGTCCTCCATCTG GGG (reversed) Intergenic
No off target data available for this crispr