ID: 1203143165

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1782209-1782231
Sequence ACACTCAGTGTCCTCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203143165_1203143170 18 Left 1203143165 16_KI270728v1_random:1782209-1782231 CCCAGATGGAGGACACTGAGTGT No data
Right 1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG No data
1203143165_1203143167 -4 Left 1203143165 16_KI270728v1_random:1782209-1782231 CCCAGATGGAGGACACTGAGTGT No data
Right 1203143167 16_KI270728v1_random:1782228-1782250 GTGTGTCTATTGTAGAGTGTAGG No data
1203143165_1203143168 -1 Left 1203143165 16_KI270728v1_random:1782209-1782231 CCCAGATGGAGGACACTGAGTGT No data
Right 1203143168 16_KI270728v1_random:1782231-1782253 TGTCTATTGTAGAGTGTAGGTGG No data
1203143165_1203143169 11 Left 1203143165 16_KI270728v1_random:1782209-1782231 CCCAGATGGAGGACACTGAGTGT No data
Right 1203143169 16_KI270728v1_random:1782243-1782265 AGTGTAGGTGGATCCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203143165 Original CRISPR ACACTCAGTGTCCTCCATCT GGG (reversed) Intergenic
No off target data available for this crispr