ID: 1203143168

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1782231-1782253
Sequence TGTCTATTGTAGAGTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203143165_1203143168 -1 Left 1203143165 16_KI270728v1_random:1782209-1782231 CCCAGATGGAGGACACTGAGTGT No data
Right 1203143168 16_KI270728v1_random:1782231-1782253 TGTCTATTGTAGAGTGTAGGTGG No data
1203143166_1203143168 -2 Left 1203143166 16_KI270728v1_random:1782210-1782232 CCAGATGGAGGACACTGAGTGTG No data
Right 1203143168 16_KI270728v1_random:1782231-1782253 TGTCTATTGTAGAGTGTAGGTGG No data
1203143164_1203143168 0 Left 1203143164 16_KI270728v1_random:1782208-1782230 CCCCAGATGGAGGACACTGAGTG No data
Right 1203143168 16_KI270728v1_random:1782231-1782253 TGTCTATTGTAGAGTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203143168 Original CRISPR TGTCTATTGTAGAGTGTAGG TGG Intergenic
No off target data available for this crispr