ID: 1203143170 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16_KI270728v1_random:1782250-1782272 |
| Sequence | GTGGATCCCCAGATGGAGTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203143164_1203143170 | 19 | Left | 1203143164 | 16_KI270728v1_random:1782208-1782230 | CCCCAGATGGAGGACACTGAGTG | No data | ||
| Right | 1203143170 | 16_KI270728v1_random:1782250-1782272 | GTGGATCCCCAGATGGAGTATGG | No data | ||||
| 1203143165_1203143170 | 18 | Left | 1203143165 | 16_KI270728v1_random:1782209-1782231 | CCCAGATGGAGGACACTGAGTGT | No data | ||
| Right | 1203143170 | 16_KI270728v1_random:1782250-1782272 | GTGGATCCCCAGATGGAGTATGG | No data | ||||
| 1203143166_1203143170 | 17 | Left | 1203143166 | 16_KI270728v1_random:1782210-1782232 | CCAGATGGAGGACACTGAGTGTG | No data | ||
| Right | 1203143170 | 16_KI270728v1_random:1782250-1782272 | GTGGATCCCCAGATGGAGTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203143170 | Original CRISPR | GTGGATCCCCAGATGGAGTA TGG | Intergenic | ||
| No off target data available for this crispr | |||||