ID: 1203143854

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1786654-1786676
Sequence CTGGTGACTCCGAGGGACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203143854_1203143861 21 Left 1203143854 16_KI270728v1_random:1786654-1786676 CCCGGGTCCCTCGGAGTCACCAG No data
Right 1203143861 16_KI270728v1_random:1786698-1786720 AGCATCATTGCCCGCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203143854 Original CRISPR CTGGTGACTCCGAGGGACCC GGG (reversed) Intergenic
No off target data available for this crispr