ID: 1203148266

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1816952-1816974
Sequence TATGGAGCAGTCGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203148266_1203148270 -8 Left 1203148266 16_KI270728v1_random:1816952-1816974 CCAGCGGCGGCGACTGCTCCATA No data
Right 1203148270 16_KI270728v1_random:1816967-1816989 GCTCCATATCCACGGGGTCCAGG No data
1203148266_1203148275 15 Left 1203148266 16_KI270728v1_random:1816952-1816974 CCAGCGGCGGCGACTGCTCCATA No data
Right 1203148275 16_KI270728v1_random:1816990-1817012 CCGCGTCCGCCTCGATCTAACGG No data
1203148266_1203148278 29 Left 1203148266 16_KI270728v1_random:1816952-1816974 CCAGCGGCGGCGACTGCTCCATA No data
Right 1203148278 16_KI270728v1_random:1817004-1817026 ATCTAACGGTCCCGCCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203148266 Original CRISPR TATGGAGCAGTCGCCGCCGC TGG (reversed) Intergenic
No off target data available for this crispr