ID: 1203148858

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1821315-1821337
Sequence AAACATGAACAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203148858_1203148869 28 Left 1203148858 16_KI270728v1_random:1821315-1821337 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203148869 16_KI270728v1_random:1821366-1821388 GGCCAGTGGGAACCGCTCCACGG No data
1203148858_1203148866 14 Left 1203148858 16_KI270728v1_random:1821315-1821337 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203148866 16_KI270728v1_random:1821352-1821374 CACCTCTAGCTAGGGGCCAGTGG No data
1203148858_1203148861 5 Left 1203148858 16_KI270728v1_random:1821315-1821337 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203148861 16_KI270728v1_random:1821343-1821365 TCTTACACCCACCTCTAGCTAGG No data
1203148858_1203148867 15 Left 1203148858 16_KI270728v1_random:1821315-1821337 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203148867 16_KI270728v1_random:1821353-1821375 ACCTCTAGCTAGGGGCCAGTGGG No data
1203148858_1203148863 7 Left 1203148858 16_KI270728v1_random:1821315-1821337 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203148863 16_KI270728v1_random:1821345-1821367 TTACACCCACCTCTAGCTAGGGG No data
1203148858_1203148862 6 Left 1203148858 16_KI270728v1_random:1821315-1821337 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203148862 16_KI270728v1_random:1821344-1821366 CTTACACCCACCTCTAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203148858 Original CRISPR AAACATGAACAAATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr