ID: 1203153248

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1855129-1855151
Sequence TGTGGAGCAGTCGCCGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203153248_1203153251 -9 Left 1203153248 16_KI270728v1_random:1855129-1855151 CCGGCAGCGGCGACTGCTCCACA No data
Right 1203153251 16_KI270728v1_random:1855143-1855165 TGCTCCACATCCACCGGGTCCGG No data
1203153248_1203153261 29 Left 1203153248 16_KI270728v1_random:1855129-1855151 CCGGCAGCGGCGACTGCTCCACA No data
Right 1203153261 16_KI270728v1_random:1855181-1855203 AGCTAACGGTCCCGCCAGCTAGG No data
1203153248_1203153258 15 Left 1203153248 16_KI270728v1_random:1855129-1855151 CCGGCAGCGGCGACTGCTCCACA No data
Right 1203153258 16_KI270728v1_random:1855167-1855189 CCGCGTCCGCCTCGAGCTAACGG No data
1203153248_1203153252 -8 Left 1203153248 16_KI270728v1_random:1855129-1855151 CCGGCAGCGGCGACTGCTCCACA No data
Right 1203153252 16_KI270728v1_random:1855144-1855166 GCTCCACATCCACCGGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203153248 Original CRISPR TGTGGAGCAGTCGCCGCTGC CGG (reversed) Intergenic
No off target data available for this crispr