ID: 1203153867

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1859501-1859523
Sequence AAACATGAACAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203153867_1203153872 6 Left 1203153867 16_KI270728v1_random:1859501-1859523 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203153872 16_KI270728v1_random:1859530-1859552 CCTACACCCACCTCTAGCTAGGG No data
1203153867_1203153876 14 Left 1203153867 16_KI270728v1_random:1859501-1859523 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203153876 16_KI270728v1_random:1859538-1859560 CACCTCTAGCTAGGGGCCAGTGG No data
1203153867_1203153877 15 Left 1203153867 16_KI270728v1_random:1859501-1859523 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203153877 16_KI270728v1_random:1859539-1859561 ACCTCTAGCTAGGGGCCAGTGGG No data
1203153867_1203153879 28 Left 1203153867 16_KI270728v1_random:1859501-1859523 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203153879 16_KI270728v1_random:1859552-1859574 GGCCAGTGGGATCCGCTCCATGG No data
1203153867_1203153873 7 Left 1203153867 16_KI270728v1_random:1859501-1859523 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203153873 16_KI270728v1_random:1859531-1859553 CTACACCCACCTCTAGCTAGGGG No data
1203153867_1203153870 5 Left 1203153867 16_KI270728v1_random:1859501-1859523 CCCAGCTCCATTTGTTCATGTTT No data
Right 1203153870 16_KI270728v1_random:1859529-1859551 TCCTACACCCACCTCTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203153867 Original CRISPR AAACATGAACAAATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr