ID: 1203154639

View in Genome Browser
Species Human (GRCh38)
Location 16_KI270728v1_random:1865531-1865553
Sequence ACCACAGTGGGGAAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203154624_1203154639 17 Left 1203154624 16_KI270728v1_random:1865491-1865513 CCCACCCAACTCCAGCCCCTCCT 0: 11
1: 1
2: 8
3: 85
4: 991
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154626_1203154639 13 Left 1203154626 16_KI270728v1_random:1865495-1865517 CCCAACTCCAGCCCCTCCTCCCA 0: 9
1: 3
2: 24
3: 193
4: 1214
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154625_1203154639 16 Left 1203154625 16_KI270728v1_random:1865492-1865514 CCACCCAACTCCAGCCCCTCCTC 0: 10
1: 2
2: 13
3: 142
4: 1368
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154631_1203154639 0 Left 1203154631 16_KI270728v1_random:1865508-1865530 CCTCCTCCCACTGAGCCAAGCAT 0: 9
1: 2
2: 4
3: 29
4: 362
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154628_1203154639 6 Left 1203154628 16_KI270728v1_random:1865502-1865524 CCAGCCCCTCCTCCCACTGAGCC 0: 9
1: 2
2: 18
3: 654
4: 1271
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154630_1203154639 1 Left 1203154630 16_KI270728v1_random:1865507-1865529 CCCTCCTCCCACTGAGCCAAGCA 0: 9
1: 2
2: 3
3: 36
4: 302
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154623_1203154639 30 Left 1203154623 16_KI270728v1_random:1865478-1865500 CCTCATGTACTTTCCCACCCAAC 0: 11
1: 1
2: 1
3: 15
4: 187
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154634_1203154639 -7 Left 1203154634 16_KI270728v1_random:1865515-1865537 CCACTGAGCCAAGCATACCACAG 0: 11
1: 0
2: 0
3: 15
4: 202
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154633_1203154639 -6 Left 1203154633 16_KI270728v1_random:1865514-1865536 CCCACTGAGCCAAGCATACCACA No data
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154627_1203154639 12 Left 1203154627 16_KI270728v1_random:1865496-1865518 CCAACTCCAGCCCCTCCTCCCAC 0: 9
1: 5
2: 19
3: 240
4: 1946
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154629_1203154639 2 Left 1203154629 16_KI270728v1_random:1865506-1865528 CCCCTCCTCCCACTGAGCCAAGC 0: 9
1: 2
2: 3
3: 30
4: 322
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data
1203154632_1203154639 -3 Left 1203154632 16_KI270728v1_random:1865511-1865533 CCTCCCACTGAGCCAAGCATACC 0: 9
1: 1
2: 2
3: 11
4: 127
Right 1203154639 16_KI270728v1_random:1865531-1865553 ACCACAGTGGGGAAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203154639 Original CRISPR ACCACAGTGGGGAAAGAGAG AGG Intergenic
No off target data available for this crispr