ID: 1203156451

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:8425-8447
Sequence CAGAACCAGCAGCAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203156447_1203156451 19 Left 1203156447 17_GL000205v2_random:8383-8405 CCCGTTGCAGTGTTCTGGAATTC No data
Right 1203156451 17_GL000205v2_random:8425-8447 CAGAACCAGCAGCAGTGTTCTGG No data
1203156448_1203156451 18 Left 1203156448 17_GL000205v2_random:8384-8406 CCGTTGCAGTGTTCTGGAATTCT No data
Right 1203156451 17_GL000205v2_random:8425-8447 CAGAACCAGCAGCAGTGTTCTGG No data
1203156445_1203156451 21 Left 1203156445 17_GL000205v2_random:8381-8403 CCCCCGTTGCAGTGTTCTGGAAT No data
Right 1203156451 17_GL000205v2_random:8425-8447 CAGAACCAGCAGCAGTGTTCTGG No data
1203156446_1203156451 20 Left 1203156446 17_GL000205v2_random:8382-8404 CCCCGTTGCAGTGTTCTGGAATT No data
Right 1203156451 17_GL000205v2_random:8425-8447 CAGAACCAGCAGCAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203156451 Original CRISPR CAGAACCAGCAGCAGTGTTC TGG Intergenic
No off target data available for this crispr