ID: 1203162990

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:68792-68814
Sequence TTGCAGCCCTACCACTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203162988_1203162990 13 Left 1203162988 17_GL000205v2_random:68756-68778 CCATTTTACCAAAGGCTAAGGCT 0: 4
1: 14
2: 6
3: 11
4: 136
Right 1203162990 17_GL000205v2_random:68792-68814 TTGCAGCCCTACCACTGAAAAGG No data
1203162989_1203162990 5 Left 1203162989 17_GL000205v2_random:68764-68786 CCAAAGGCTAAGGCTAAAATACT 0: 5
1: 14
2: 3
3: 14
4: 154
Right 1203162990 17_GL000205v2_random:68792-68814 TTGCAGCCCTACCACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203162990 Original CRISPR TTGCAGCCCTACCACTGAAA AGG Intergenic
No off target data available for this crispr