ID: 1203165181

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87193-87215
Sequence GGACCCCTCCTTCTGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165181_1203165187 23 Left 1203165181 17_GL000205v2_random:87193-87215 CCAGGAAGCAGAAGGAGGGGTCC No data
Right 1203165187 17_GL000205v2_random:87239-87261 AATGCGCACTGTCCCTGAGCTGG No data
1203165181_1203165188 24 Left 1203165181 17_GL000205v2_random:87193-87215 CCAGGAAGCAGAAGGAGGGGTCC No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165181 Original CRISPR GGACCCCTCCTTCTGCTTCC TGG (reversed) Intergenic