ID: 1203165182

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87214-87236
Sequence TGGAGGAAAAGGCTAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165182_1203165189 13 Left 1203165182 17_GL000205v2_random:87214-87236 CCACAGCCTAGCCTTTTCCTCCA No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data
1203165182_1203165187 2 Left 1203165182 17_GL000205v2_random:87214-87236 CCACAGCCTAGCCTTTTCCTCCA No data
Right 1203165187 17_GL000205v2_random:87239-87261 AATGCGCACTGTCCCTGAGCTGG No data
1203165182_1203165188 3 Left 1203165182 17_GL000205v2_random:87214-87236 CCACAGCCTAGCCTTTTCCTCCA No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data
1203165182_1203165191 14 Left 1203165182 17_GL000205v2_random:87214-87236 CCACAGCCTAGCCTTTTCCTCCA No data
Right 1203165191 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165182 Original CRISPR TGGAGGAAAAGGCTAGGCTG TGG (reversed) Intergenic