ID: 1203165184

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87225-87247
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165184_1203165189 2 Left 1203165184 17_GL000205v2_random:87225-87247 CCTTTTCCTCCAGTAATGCGCAC No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data
1203165184_1203165188 -8 Left 1203165184 17_GL000205v2_random:87225-87247 CCTTTTCCTCCAGTAATGCGCAC No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data
1203165184_1203165187 -9 Left 1203165184 17_GL000205v2_random:87225-87247 CCTTTTCCTCCAGTAATGCGCAC No data
Right 1203165187 17_GL000205v2_random:87239-87261 AATGCGCACTGTCCCTGAGCTGG No data
1203165184_1203165191 3 Left 1203165184 17_GL000205v2_random:87225-87247 CCTTTTCCTCCAGTAATGCGCAC No data
Right 1203165191 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data
1203165184_1203165193 23 Left 1203165184 17_GL000205v2_random:87225-87247 CCTTTTCCTCCAGTAATGCGCAC No data
Right 1203165193 17_GL000205v2_random:87271-87293 GGGATTGTAGTCCTGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165184 Original CRISPR GTGCGCATTACTGGAGGAAA AGG (reversed) Intergenic