ID: 1203165185

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87231-87253
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165185_1203165194 27 Left 1203165185 17_GL000205v2_random:87231-87253 CCTCCAGTAATGCGCACTGTCCC No data
Right 1203165194 17_GL000205v2_random:87281-87303 TCCTGCAGCCCGGTGATGAAAGG No data
1203165185_1203165193 17 Left 1203165185 17_GL000205v2_random:87231-87253 CCTCCAGTAATGCGCACTGTCCC No data
Right 1203165193 17_GL000205v2_random:87271-87293 GGGATTGTAGTCCTGCAGCCCGG No data
1203165185_1203165189 -4 Left 1203165185 17_GL000205v2_random:87231-87253 CCTCCAGTAATGCGCACTGTCCC No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data
1203165185_1203165191 -3 Left 1203165185 17_GL000205v2_random:87231-87253 CCTCCAGTAATGCGCACTGTCCC No data
Right 1203165191 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165185 Original CRISPR GGGACAGTGCGCATTACTGG AGG (reversed) Intergenic
No off target data available for this crispr