ID: 1203165186

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87234-87256
Sequence TCAGGGACAGTGCGCATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165186_1203165189 -7 Left 1203165186 17_GL000205v2_random:87234-87256 CCAGTAATGCGCACTGTCCCTGA No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data
1203165186_1203165194 24 Left 1203165186 17_GL000205v2_random:87234-87256 CCAGTAATGCGCACTGTCCCTGA No data
Right 1203165194 17_GL000205v2_random:87281-87303 TCCTGCAGCCCGGTGATGAAAGG No data
1203165186_1203165197 30 Left 1203165186 17_GL000205v2_random:87234-87256 CCAGTAATGCGCACTGTCCCTGA No data
Right 1203165197 17_GL000205v2_random:87287-87309 AGCCCGGTGATGAAAGGTCTGGG No data
1203165186_1203165191 -6 Left 1203165186 17_GL000205v2_random:87234-87256 CCAGTAATGCGCACTGTCCCTGA No data
Right 1203165191 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data
1203165186_1203165196 29 Left 1203165186 17_GL000205v2_random:87234-87256 CCAGTAATGCGCACTGTCCCTGA No data
Right 1203165196 17_GL000205v2_random:87286-87308 CAGCCCGGTGATGAAAGGTCTGG No data
1203165186_1203165193 14 Left 1203165186 17_GL000205v2_random:87234-87256 CCAGTAATGCGCACTGTCCCTGA No data
Right 1203165193 17_GL000205v2_random:87271-87293 GGGATTGTAGTCCTGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165186 Original CRISPR TCAGGGACAGTGCGCATTAC TGG (reversed) Intergenic