ID: 1203165188

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87240-87262
Sequence ATGCGCACTGTCCCTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165183_1203165188 -3 Left 1203165183 17_GL000205v2_random:87220-87242 CCTAGCCTTTTCCTCCAGTAATG No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data
1203165176_1203165188 30 Left 1203165176 17_GL000205v2_random:87187-87209 CCTCTCCCAGGAAGCAGAAGGAG No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data
1203165181_1203165188 24 Left 1203165181 17_GL000205v2_random:87193-87215 CCAGGAAGCAGAAGGAGGGGTCC No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data
1203165180_1203165188 25 Left 1203165180 17_GL000205v2_random:87192-87214 CCCAGGAAGCAGAAGGAGGGGTC No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data
1203165184_1203165188 -8 Left 1203165184 17_GL000205v2_random:87225-87247 CCTTTTCCTCCAGTAATGCGCAC No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data
1203165182_1203165188 3 Left 1203165182 17_GL000205v2_random:87214-87236 CCACAGCCTAGCCTTTTCCTCCA No data
Right 1203165188 17_GL000205v2_random:87240-87262 ATGCGCACTGTCCCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165188 Original CRISPR ATGCGCACTGTCCCTGAGCT GGG Intergenic