ID: 1203165189

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87250-87272
Sequence TCCCTGAGCTGGGTGCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165183_1203165189 7 Left 1203165183 17_GL000205v2_random:87220-87242 CCTAGCCTTTTCCTCCAGTAATG No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data
1203165185_1203165189 -4 Left 1203165185 17_GL000205v2_random:87231-87253 CCTCCAGTAATGCGCACTGTCCC No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data
1203165186_1203165189 -7 Left 1203165186 17_GL000205v2_random:87234-87256 CCAGTAATGCGCACTGTCCCTGA No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data
1203165182_1203165189 13 Left 1203165182 17_GL000205v2_random:87214-87236 CCACAGCCTAGCCTTTTCCTCCA No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data
1203165184_1203165189 2 Left 1203165184 17_GL000205v2_random:87225-87247 CCTTTTCCTCCAGTAATGCGCAC No data
Right 1203165189 17_GL000205v2_random:87250-87272 TCCCTGAGCTGGGTGCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165189 Original CRISPR TCCCTGAGCTGGGTGCATGC TGG Intergenic