ID: 1203165190

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87251-87273
Sequence CCCAGCATGCACCCAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165190_1203165193 -3 Left 1203165190 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data
Right 1203165193 17_GL000205v2_random:87271-87293 GGGATTGTAGTCCTGCAGCCCGG No data
1203165190_1203165194 7 Left 1203165190 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data
Right 1203165194 17_GL000205v2_random:87281-87303 TCCTGCAGCCCGGTGATGAAAGG No data
1203165190_1203165197 13 Left 1203165190 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data
Right 1203165197 17_GL000205v2_random:87287-87309 AGCCCGGTGATGAAAGGTCTGGG No data
1203165190_1203165196 12 Left 1203165190 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data
Right 1203165196 17_GL000205v2_random:87286-87308 CAGCCCGGTGATGAAAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165190 Original CRISPR CCCAGCATGCACCCAGCTCA GGG (reversed) Intergenic