ID: 1203165192

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87252-87274
Sequence TCCCAGCATGCACCCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165192_1203165196 11 Left 1203165192 17_GL000205v2_random:87252-87274 CCTGAGCTGGGTGCATGCTGGGA No data
Right 1203165196 17_GL000205v2_random:87286-87308 CAGCCCGGTGATGAAAGGTCTGG No data
1203165192_1203165193 -4 Left 1203165192 17_GL000205v2_random:87252-87274 CCTGAGCTGGGTGCATGCTGGGA No data
Right 1203165193 17_GL000205v2_random:87271-87293 GGGATTGTAGTCCTGCAGCCCGG No data
1203165192_1203165194 6 Left 1203165192 17_GL000205v2_random:87252-87274 CCTGAGCTGGGTGCATGCTGGGA No data
Right 1203165194 17_GL000205v2_random:87281-87303 TCCTGCAGCCCGGTGATGAAAGG No data
1203165192_1203165197 12 Left 1203165192 17_GL000205v2_random:87252-87274 CCTGAGCTGGGTGCATGCTGGGA No data
Right 1203165197 17_GL000205v2_random:87287-87309 AGCCCGGTGATGAAAGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165192 Original CRISPR TCCCAGCATGCACCCAGCTC AGG (reversed) Intergenic
No off target data available for this crispr