ID: 1203165194

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:87281-87303
Sequence TCCTGCAGCCCGGTGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165192_1203165194 6 Left 1203165192 17_GL000205v2_random:87252-87274 CCTGAGCTGGGTGCATGCTGGGA No data
Right 1203165194 17_GL000205v2_random:87281-87303 TCCTGCAGCCCGGTGATGAAAGG No data
1203165185_1203165194 27 Left 1203165185 17_GL000205v2_random:87231-87253 CCTCCAGTAATGCGCACTGTCCC No data
Right 1203165194 17_GL000205v2_random:87281-87303 TCCTGCAGCCCGGTGATGAAAGG No data
1203165186_1203165194 24 Left 1203165186 17_GL000205v2_random:87234-87256 CCAGTAATGCGCACTGTCCCTGA No data
Right 1203165194 17_GL000205v2_random:87281-87303 TCCTGCAGCCCGGTGATGAAAGG No data
1203165190_1203165194 7 Left 1203165190 17_GL000205v2_random:87251-87273 CCCTGAGCTGGGTGCATGCTGGG No data
Right 1203165194 17_GL000205v2_random:87281-87303 TCCTGCAGCCCGGTGATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165194 Original CRISPR TCCTGCAGCCCGGTGATGAA AGG Intergenic
No off target data available for this crispr