ID: 1203165197 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17_GL000205v2_random:87287-87309 |
Sequence | AGCCCGGTGATGAAAGGTCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1203165192_1203165197 | 12 | Left | 1203165192 | 17_GL000205v2_random:87252-87274 | CCTGAGCTGGGTGCATGCTGGGA | No data | ||
Right | 1203165197 | 17_GL000205v2_random:87287-87309 | AGCCCGGTGATGAAAGGTCTGGG | No data | ||||
1203165186_1203165197 | 30 | Left | 1203165186 | 17_GL000205v2_random:87234-87256 | CCAGTAATGCGCACTGTCCCTGA | No data | ||
Right | 1203165197 | 17_GL000205v2_random:87287-87309 | AGCCCGGTGATGAAAGGTCTGGG | No data | ||||
1203165190_1203165197 | 13 | Left | 1203165190 | 17_GL000205v2_random:87251-87273 | CCCTGAGCTGGGTGCATGCTGGG | No data | ||
Right | 1203165197 | 17_GL000205v2_random:87287-87309 | AGCCCGGTGATGAAAGGTCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203165197 | Original CRISPR | AGCCCGGTGATGAAAGGTCT GGG | Intergenic | ||