ID: 1203165393

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:88663-88685
Sequence TAGTCTAAGGAGAAAGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165393_1203165396 -3 Left 1203165393 17_GL000205v2_random:88663-88685 CCGGCCTCTTTCTCCTTAGACTA No data
Right 1203165396 17_GL000205v2_random:88683-88705 CTAGCGCACTGTCACTGAGCTGG No data
1203165393_1203165398 9 Left 1203165393 17_GL000205v2_random:88663-88685 CCGGCCTCTTTCTCCTTAGACTA No data
Right 1203165398 17_GL000205v2_random:88695-88717 CACTGAGCTGGGTGCATACTAGG No data
1203165393_1203165397 -2 Left 1203165393 17_GL000205v2_random:88663-88685 CCGGCCTCTTTCTCCTTAGACTA No data
Right 1203165397 17_GL000205v2_random:88684-88706 TAGCGCACTGTCACTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165393 Original CRISPR TAGTCTAAGGAGAAAGAGGC CGG (reversed) Intergenic
No off target data available for this crispr