ID: 1203165616

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:90264-90286
Sequence TCCCTGTGTTGGGGGAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203165611_1203165616 7 Left 1203165611 17_GL000205v2_random:90234-90256 CCATAAAACAAAGGGAATTTGTT No data
Right 1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203165616 Original CRISPR TCCCTGTGTTGGGGGAGTGT TGG Intergenic
No off target data available for this crispr