ID: 1203170046

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:140423-140445
Sequence GGCCCTCGCTGCTGGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203170035_1203170046 14 Left 1203170035 17_GL000205v2_random:140386-140408 CCCAGGGACAGGACCGGATGGGC No data
Right 1203170046 17_GL000205v2_random:140423-140445 GGCCCTCGCTGCTGGCCCAGCGG No data
1203170044_1203170046 -8 Left 1203170044 17_GL000205v2_random:140408-140430 CCGGACGGGACGTGGGGCCCTCG No data
Right 1203170046 17_GL000205v2_random:140423-140445 GGCCCTCGCTGCTGGCCCAGCGG No data
1203170036_1203170046 13 Left 1203170036 17_GL000205v2_random:140387-140409 CCAGGGACAGGACCGGATGGGCC No data
Right 1203170046 17_GL000205v2_random:140423-140445 GGCCCTCGCTGCTGGCCCAGCGG No data
1203170040_1203170046 1 Left 1203170040 17_GL000205v2_random:140399-140421 CCGGATGGGCCGGACGGGACGTG No data
Right 1203170046 17_GL000205v2_random:140423-140445 GGCCCTCGCTGCTGGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203170046 Original CRISPR GGCCCTCGCTGCTGGCCCAG CGG Intergenic