ID: 1203170913

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:147320-147342
Sequence ACAGGTGACTGTGCCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203170913_1203170917 -2 Left 1203170913 17_GL000205v2_random:147320-147342 CCCACCTCGGCACAGTCACCTGT No data
Right 1203170917 17_GL000205v2_random:147341-147363 GTAGTGTACTGAGATGAGCAAGG No data
1203170913_1203170920 27 Left 1203170913 17_GL000205v2_random:147320-147342 CCCACCTCGGCACAGTCACCTGT No data
Right 1203170920 17_GL000205v2_random:147370-147392 AAGTAGACACAAATCCCCATGGG No data
1203170913_1203170919 26 Left 1203170913 17_GL000205v2_random:147320-147342 CCCACCTCGGCACAGTCACCTGT No data
Right 1203170919 17_GL000205v2_random:147369-147391 CAAGTAGACACAAATCCCCATGG No data
1203170913_1203170918 1 Left 1203170913 17_GL000205v2_random:147320-147342 CCCACCTCGGCACAGTCACCTGT No data
Right 1203170918 17_GL000205v2_random:147344-147366 GTGTACTGAGATGAGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203170913 Original CRISPR ACAGGTGACTGTGCCGAGGT GGG (reversed) Intergenic
No off target data available for this crispr