ID: 1203170916

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:147338-147360
Sequence TGCTCATCTCAGTACACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203170916_1203170919 8 Left 1203170916 17_GL000205v2_random:147338-147360 CCTGTAGTGTACTGAGATGAGCA No data
Right 1203170919 17_GL000205v2_random:147369-147391 CAAGTAGACACAAATCCCCATGG No data
1203170916_1203170921 14 Left 1203170916 17_GL000205v2_random:147338-147360 CCTGTAGTGTACTGAGATGAGCA No data
Right 1203170921 17_GL000205v2_random:147375-147397 GACACAAATCCCCATGGGCTTGG No data
1203170916_1203170920 9 Left 1203170916 17_GL000205v2_random:147338-147360 CCTGTAGTGTACTGAGATGAGCA No data
Right 1203170920 17_GL000205v2_random:147370-147392 AAGTAGACACAAATCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203170916 Original CRISPR TGCTCATCTCAGTACACTAC AGG (reversed) Intergenic
No off target data available for this crispr