ID: 1203170919

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:147369-147391
Sequence CAAGTAGACACAAATCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203170915_1203170919 22 Left 1203170915 17_GL000205v2_random:147324-147346 CCTCGGCACAGTCACCTGTAGTG No data
Right 1203170919 17_GL000205v2_random:147369-147391 CAAGTAGACACAAATCCCCATGG No data
1203170916_1203170919 8 Left 1203170916 17_GL000205v2_random:147338-147360 CCTGTAGTGTACTGAGATGAGCA No data
Right 1203170919 17_GL000205v2_random:147369-147391 CAAGTAGACACAAATCCCCATGG No data
1203170913_1203170919 26 Left 1203170913 17_GL000205v2_random:147320-147342 CCCACCTCGGCACAGTCACCTGT No data
Right 1203170919 17_GL000205v2_random:147369-147391 CAAGTAGACACAAATCCCCATGG No data
1203170914_1203170919 25 Left 1203170914 17_GL000205v2_random:147321-147343 CCACCTCGGCACAGTCACCTGTA No data
Right 1203170919 17_GL000205v2_random:147369-147391 CAAGTAGACACAAATCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203170919 Original CRISPR CAAGTAGACACAAATCCCCA TGG Intergenic
No off target data available for this crispr