ID: 1203170921

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:147375-147397
Sequence GACACAAATCCCCATGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203170915_1203170921 28 Left 1203170915 17_GL000205v2_random:147324-147346 CCTCGGCACAGTCACCTGTAGTG No data
Right 1203170921 17_GL000205v2_random:147375-147397 GACACAAATCCCCATGGGCTTGG No data
1203170916_1203170921 14 Left 1203170916 17_GL000205v2_random:147338-147360 CCTGTAGTGTACTGAGATGAGCA No data
Right 1203170921 17_GL000205v2_random:147375-147397 GACACAAATCCCCATGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203170921 Original CRISPR GACACAAATCCCCATGGGCT TGG Intergenic
No off target data available for this crispr