ID: 1203171336

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:149785-149807
Sequence CAGAGGAAAAAGGAGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203171336_1203171349 24 Left 1203171336 17_GL000205v2_random:149785-149807 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1203171349 17_GL000205v2_random:149832-149854 CGCAACTCTCAGGTCACCATTGG No data
1203171336_1203171345 14 Left 1203171336 17_GL000205v2_random:149785-149807 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1203171345 17_GL000205v2_random:149822-149844 CAATGCCTCCCGCAACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203171336 Original CRISPR CAGAGGAAAAAGGAGCATGG AGG (reversed) Intergenic
No off target data available for this crispr