ID: 1203171345

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:149822-149844
Sequence CAATGCCTCCCGCAACTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203171336_1203171345 14 Left 1203171336 17_GL000205v2_random:149785-149807 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1203171345 17_GL000205v2_random:149822-149844 CAATGCCTCCCGCAACTCTCAGG No data
1203171337_1203171345 11 Left 1203171337 17_GL000205v2_random:149788-149810 CCATGCTCCTTTTTCCTCTGTTC No data
Right 1203171345 17_GL000205v2_random:149822-149844 CAATGCCTCCCGCAACTCTCAGG No data
1203171334_1203171345 27 Left 1203171334 17_GL000205v2_random:149772-149794 CCTCAGCACCTGGCCTCCATGCT No data
Right 1203171345 17_GL000205v2_random:149822-149844 CAATGCCTCCCGCAACTCTCAGG No data
1203171338_1203171345 4 Left 1203171338 17_GL000205v2_random:149795-149817 CCTTTTTCCTCTGTTCAATCCTG No data
Right 1203171345 17_GL000205v2_random:149822-149844 CAATGCCTCCCGCAACTCTCAGG No data
1203171335_1203171345 19 Left 1203171335 17_GL000205v2_random:149780-149802 CCTGGCCTCCATGCTCCTTTTTC No data
Right 1203171345 17_GL000205v2_random:149822-149844 CAATGCCTCCCGCAACTCTCAGG No data
1203171340_1203171345 -3 Left 1203171340 17_GL000205v2_random:149802-149824 CCTCTGTTCAATCCTGGCCCCAA No data
Right 1203171345 17_GL000205v2_random:149822-149844 CAATGCCTCCCGCAACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203171345 Original CRISPR CAATGCCTCCCGCAACTCTC AGG Intergenic
No off target data available for this crispr