ID: 1203171349

View in Genome Browser
Species Human (GRCh38)
Location 17_GL000205v2_random:149832-149854
Sequence CGCAACTCTCAGGTCACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203171337_1203171349 21 Left 1203171337 17_GL000205v2_random:149788-149810 CCATGCTCCTTTTTCCTCTGTTC No data
Right 1203171349 17_GL000205v2_random:149832-149854 CGCAACTCTCAGGTCACCATTGG No data
1203171338_1203171349 14 Left 1203171338 17_GL000205v2_random:149795-149817 CCTTTTTCCTCTGTTCAATCCTG No data
Right 1203171349 17_GL000205v2_random:149832-149854 CGCAACTCTCAGGTCACCATTGG No data
1203171341_1203171349 -5 Left 1203171341 17_GL000205v2_random:149814-149836 CCTGGCCCCAATGCCTCCCGCAA No data
Right 1203171349 17_GL000205v2_random:149832-149854 CGCAACTCTCAGGTCACCATTGG No data
1203171340_1203171349 7 Left 1203171340 17_GL000205v2_random:149802-149824 CCTCTGTTCAATCCTGGCCCCAA No data
Right 1203171349 17_GL000205v2_random:149832-149854 CGCAACTCTCAGGTCACCATTGG No data
1203171335_1203171349 29 Left 1203171335 17_GL000205v2_random:149780-149802 CCTGGCCTCCATGCTCCTTTTTC No data
Right 1203171349 17_GL000205v2_random:149832-149854 CGCAACTCTCAGGTCACCATTGG No data
1203171342_1203171349 -10 Left 1203171342 17_GL000205v2_random:149819-149841 CCCCAATGCCTCCCGCAACTCTC No data
Right 1203171349 17_GL000205v2_random:149832-149854 CGCAACTCTCAGGTCACCATTGG No data
1203171336_1203171349 24 Left 1203171336 17_GL000205v2_random:149785-149807 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1203171349 17_GL000205v2_random:149832-149854 CGCAACTCTCAGGTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203171349 Original CRISPR CGCAACTCTCAGGTCACCAT TGG Intergenic
No off target data available for this crispr