ID: 1203180362

View in Genome Browser
Species Human (GRCh38)
Location 17_KI270729v1_random:51849-51871
Sequence TGGATTGGAATACAATAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203180360_1203180362 -4 Left 1203180360 17_KI270729v1_random:51830-51852 CCAAATGGAATGGACAGAATGGA No data
Right 1203180362 17_KI270729v1_random:51849-51871 TGGATTGGAATACAATAGAAAGG No data
1203180358_1203180362 -3 Left 1203180358 17_KI270729v1_random:51829-51851 CCCAAATGGAATGGACAGAATGG No data
Right 1203180362 17_KI270729v1_random:51849-51871 TGGATTGGAATACAATAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203180362 Original CRISPR TGGATTGGAATACAATAGAA AGG Intergenic
No off target data available for this crispr