ID: 1203192473 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17_KI270729v1_random:202171-202193 |
Sequence | TATTATCTTTAGAAGTTTTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1203192471_1203192473 | 7 | Left | 1203192471 | 17_KI270729v1_random:202141-202163 | CCCACTGGGGCTATTAAGGTAGT | No data | ||
Right | 1203192473 | 17_KI270729v1_random:202171-202193 | TATTATCTTTAGAAGTTTTATGG | No data | ||||
1203192472_1203192473 | 6 | Left | 1203192472 | 17_KI270729v1_random:202142-202164 | CCACTGGGGCTATTAAGGTAGTT | No data | ||
Right | 1203192473 | 17_KI270729v1_random:202171-202193 | TATTATCTTTAGAAGTTTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203192473 | Original CRISPR | TATTATCTTTAGAAGTTTTA TGG | Intergenic | ||
No off target data available for this crispr |