ID: 1203192473

View in Genome Browser
Species Human (GRCh38)
Location 17_KI270729v1_random:202171-202193
Sequence TATTATCTTTAGAAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203192471_1203192473 7 Left 1203192471 17_KI270729v1_random:202141-202163 CCCACTGGGGCTATTAAGGTAGT No data
Right 1203192473 17_KI270729v1_random:202171-202193 TATTATCTTTAGAAGTTTTATGG No data
1203192472_1203192473 6 Left 1203192472 17_KI270729v1_random:202142-202164 CCACTGGGGCTATTAAGGTAGTT No data
Right 1203192473 17_KI270729v1_random:202171-202193 TATTATCTTTAGAAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203192473 Original CRISPR TATTATCTTTAGAAGTTTTA TGG Intergenic
No off target data available for this crispr