ID: 1203201838

View in Genome Browser
Species Human (GRCh38)
Location 17_KI270730v1_random:1606-1628
Sequence TATTATCTTTAGAAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203201836_1203201838 7 Left 1203201836 17_KI270730v1_random:1576-1598 CCCACTGGGGCTATTAAGGTAGT No data
Right 1203201838 17_KI270730v1_random:1606-1628 TATTATCTTTAGAAGTTTTATGG No data
1203201837_1203201838 6 Left 1203201837 17_KI270730v1_random:1577-1599 CCACTGGGGCTATTAAGGTAGTT No data
Right 1203201838 17_KI270730v1_random:1606-1628 TATTATCTTTAGAAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203201838 Original CRISPR TATTATCTTTAGAAGTTTTA TGG Intergenic
No off target data available for this crispr