ID: 1203216905

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:11362-11384
Sequence GCTGAGGCCCAGAAATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203216901_1203216905 2 Left 1203216901 22_KI270731v1_random:11337-11359 CCTCTGGGCACCTGCTGCAGCTG No data
Right 1203216905 22_KI270731v1_random:11362-11384 GCTGAGGCCCAGAAATGTGAAGG No data
1203216898_1203216905 30 Left 1203216898 22_KI270731v1_random:11309-11331 CCGGGAGGTCTGGGATCTCTGGT No data
Right 1203216905 22_KI270731v1_random:11362-11384 GCTGAGGCCCAGAAATGTGAAGG No data
1203216904_1203216905 -8 Left 1203216904 22_KI270731v1_random:11347-11369 CCTGCTGCAGCTGTGGCTGAGGC No data
Right 1203216905 22_KI270731v1_random:11362-11384 GCTGAGGCCCAGAAATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203216905 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG Intergenic
No off target data available for this crispr