ID: 1203221159

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:44400-44422
Sequence TATCCAAGGCTTCTAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203221159_1203221162 -5 Left 1203221159 22_KI270731v1_random:44400-44422 CCAGACTTTAGAAGCCTTGGATA No data
Right 1203221162 22_KI270731v1_random:44418-44440 GGATACCAAGACACGGAGTTTGG No data
1203221159_1203221166 27 Left 1203221159 22_KI270731v1_random:44400-44422 CCAGACTTTAGAAGCCTTGGATA No data
Right 1203221166 22_KI270731v1_random:44450-44472 GATTGGCAAAGTGGAATCTCCGG No data
1203221159_1203221164 10 Left 1203221159 22_KI270731v1_random:44400-44422 CCAGACTTTAGAAGCCTTGGATA No data
Right 1203221164 22_KI270731v1_random:44433-44455 GAGTTTGGACTTGATGTGATTGG No data
1203221159_1203221165 18 Left 1203221159 22_KI270731v1_random:44400-44422 CCAGACTTTAGAAGCCTTGGATA No data
Right 1203221165 22_KI270731v1_random:44441-44463 ACTTGATGTGATTGGCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203221159 Original CRISPR TATCCAAGGCTTCTAAAGTC TGG (reversed) Intergenic
No off target data available for this crispr