ID: 1203223653

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:63874-63896
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203223653_1203223662 -5 Left 1203223653 22_KI270731v1_random:63874-63896 CCTGACCTGCCTCCAGCCTTCTT No data
Right 1203223662 22_KI270731v1_random:63892-63914 TTCTTTGCAGGAGATGGATGGGG No data
1203223653_1203223660 -7 Left 1203223653 22_KI270731v1_random:63874-63896 CCTGACCTGCCTCCAGCCTTCTT No data
Right 1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG No data
1203223653_1203223664 0 Left 1203223653 22_KI270731v1_random:63874-63896 CCTGACCTGCCTCCAGCCTTCTT No data
Right 1203223664 22_KI270731v1_random:63897-63919 TGCAGGAGATGGATGGGGGTTGG No data
1203223653_1203223663 -4 Left 1203223653 22_KI270731v1_random:63874-63896 CCTGACCTGCCTCCAGCCTTCTT No data
Right 1203223663 22_KI270731v1_random:63893-63915 TCTTTGCAGGAGATGGATGGGGG No data
1203223653_1203223661 -6 Left 1203223653 22_KI270731v1_random:63874-63896 CCTGACCTGCCTCCAGCCTTCTT No data
Right 1203223661 22_KI270731v1_random:63891-63913 CTTCTTTGCAGGAGATGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203223653 Original CRISPR AAGAAGGCTGGAGGCAGGTC AGG (reversed) Intergenic
No off target data available for this crispr