ID: 1203223660

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:63890-63912
Sequence CCTTCTTTGCAGGAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203223652_1203223660 -6 Left 1203223652 22_KI270731v1_random:63873-63895 CCCTGACCTGCCTCCAGCCTTCT No data
Right 1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG No data
1203223653_1203223660 -7 Left 1203223653 22_KI270731v1_random:63874-63896 CCTGACCTGCCTCCAGCCTTCTT No data
Right 1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203223660 Original CRISPR CCTTCTTTGCAGGAGATGGA TGG Intergenic
No off target data available for this crispr