ID: 1203230815

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:108497-108519
Sequence TCCCACCCTAGCTGAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203230808_1203230815 13 Left 1203230808 22_KI270731v1_random:108461-108483 CCAGGATAAGTCATTAGAGAGAG No data
Right 1203230815 22_KI270731v1_random:108497-108519 TCCCACCCTAGCTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203230815 Original CRISPR TCCCACCCTAGCTGAAGCCA TGG Intergenic
No off target data available for this crispr