ID: 1203230894

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:109047-109069
Sequence CACCCCAGTGTGCCTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203230888_1203230894 17 Left 1203230888 22_KI270731v1_random:109007-109029 CCTCTGCATTGCAGTGGATCGTG No data
Right 1203230894 22_KI270731v1_random:109047-109069 CACCCCAGTGTGCCTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203230894 Original CRISPR CACCCCAGTGTGCCTGGCAT GGG Intergenic
No off target data available for this crispr