ID: 1203233627

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:134481-134503
Sequence TATTTCAGCAGAAACCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203233626_1203233627 -1 Left 1203233626 22_KI270731v1_random:134459-134481 CCTCTAGAAGATTATCAGTGGAT No data
Right 1203233627 22_KI270731v1_random:134481-134503 TATTTCAGCAGAAACCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203233627 Original CRISPR TATTTCAGCAGAAACCCTGC AGG Intergenic
No off target data available for this crispr