ID: 1203234570

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:142649-142671
Sequence GGACGAAGCCTCGGCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203234570_1203234577 6 Left 1203234570 22_KI270731v1_random:142649-142671 CCAGGAAGGCCGAGGCTTCGTCC No data
Right 1203234577 22_KI270731v1_random:142678-142700 CCCTGCTGCCAAAGACACTGGGG No data
1203234570_1203234580 8 Left 1203234570 22_KI270731v1_random:142649-142671 CCAGGAAGGCCGAGGCTTCGTCC No data
Right 1203234580 22_KI270731v1_random:142680-142702 CTGCTGCCAAAGACACTGGGGGG No data
1203234570_1203234579 7 Left 1203234570 22_KI270731v1_random:142649-142671 CCAGGAAGGCCGAGGCTTCGTCC No data
Right 1203234579 22_KI270731v1_random:142679-142701 CCTGCTGCCAAAGACACTGGGGG No data
1203234570_1203234574 4 Left 1203234570 22_KI270731v1_random:142649-142671 CCAGGAAGGCCGAGGCTTCGTCC No data
Right 1203234574 22_KI270731v1_random:142676-142698 GGCCCTGCTGCCAAAGACACTGG No data
1203234570_1203234582 19 Left 1203234570 22_KI270731v1_random:142649-142671 CCAGGAAGGCCGAGGCTTCGTCC No data
Right 1203234582 22_KI270731v1_random:142691-142713 GACACTGGGGGGTTTCTTCCTGG No data
1203234570_1203234575 5 Left 1203234570 22_KI270731v1_random:142649-142671 CCAGGAAGGCCGAGGCTTCGTCC No data
Right 1203234575 22_KI270731v1_random:142677-142699 GCCCTGCTGCCAAAGACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203234570 Original CRISPR GGACGAAGCCTCGGCCTTCC TGG (reversed) Intergenic
No off target data available for this crispr