ID: 1203234573

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:142670-142692
Sequence TCTTTGGCAGCAGGGCCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203234573_1203234584 22 Left 1203234573 22_KI270731v1_random:142670-142692 CCTCTCGGCCCTGCTGCCAAAGA No data
Right 1203234584 22_KI270731v1_random:142715-142737 GCCCTCGCAGCTGTCTCTCTTGG No data
1203234573_1203234587 29 Left 1203234573 22_KI270731v1_random:142670-142692 CCTCTCGGCCCTGCTGCCAAAGA No data
Right 1203234587 22_KI270731v1_random:142722-142744 CAGCTGTCTCTCTTGGACTTAGG No data
1203234573_1203234582 -2 Left 1203234573 22_KI270731v1_random:142670-142692 CCTCTCGGCCCTGCTGCCAAAGA No data
Right 1203234582 22_KI270731v1_random:142691-142713 GACACTGGGGGGTTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203234573 Original CRISPR TCTTTGGCAGCAGGGCCGAG AGG (reversed) Intergenic
No off target data available for this crispr