ID: 1203234578

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:142679-142701
Sequence CCCCCAGTGTCTTTGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203234578_1203234587 20 Left 1203234578 22_KI270731v1_random:142679-142701 CCTGCTGCCAAAGACACTGGGGG No data
Right 1203234587 22_KI270731v1_random:142722-142744 CAGCTGTCTCTCTTGGACTTAGG No data
1203234578_1203234584 13 Left 1203234578 22_KI270731v1_random:142679-142701 CCTGCTGCCAAAGACACTGGGGG No data
Right 1203234584 22_KI270731v1_random:142715-142737 GCCCTCGCAGCTGTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203234578 Original CRISPR CCCCCAGTGTCTTTGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr