ID: 1203234582

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:142691-142713
Sequence GACACTGGGGGGTTTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203234573_1203234582 -2 Left 1203234573 22_KI270731v1_random:142670-142692 CCTCTCGGCCCTGCTGCCAAAGA No data
Right 1203234582 22_KI270731v1_random:142691-142713 GACACTGGGGGGTTTCTTCCTGG No data
1203234576_1203234582 -10 Left 1203234576 22_KI270731v1_random:142678-142700 CCCTGCTGCCAAAGACACTGGGG No data
Right 1203234582 22_KI270731v1_random:142691-142713 GACACTGGGGGGTTTCTTCCTGG No data
1203234572_1203234582 10 Left 1203234572 22_KI270731v1_random:142658-142680 CCGAGGCTTCGTCCTCTCGGCCC No data
Right 1203234582 22_KI270731v1_random:142691-142713 GACACTGGGGGGTTTCTTCCTGG No data
1203234569_1203234582 24 Left 1203234569 22_KI270731v1_random:142644-142666 CCTCACCAGGAAGGCCGAGGCTT No data
Right 1203234582 22_KI270731v1_random:142691-142713 GACACTGGGGGGTTTCTTCCTGG No data
1203234570_1203234582 19 Left 1203234570 22_KI270731v1_random:142649-142671 CCAGGAAGGCCGAGGCTTCGTCC No data
Right 1203234582 22_KI270731v1_random:142691-142713 GACACTGGGGGGTTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203234582 Original CRISPR GACACTGGGGGGTTTCTTCC TGG Intergenic
No off target data available for this crispr